Меню
Набор скоро начнётся NCT07397741

Evaluation of CCR6 Gene Expression and Circulating CCL20 Levels as Potential Biomarkers in Rheumatoid Arthritis

Наблюдательное Rhematoid Arthritis

Ориентир для пациента и семьи

Простыми словами

Автоматическая сводка по структурированным данным реестра. Она помогает сориентироваться, но не заменяет официальный протокол или оценку врача.

Что изучают
В протоколе указаны: Gene expression by quantitative Real Time PCR.
Кому может быть актуально
Состояния в реестре: Rhematoid Arthritis. Базовые параметры: 18 лет — 60 лет · Все.
Что важно проверить
Возраст, диагноз и пол — только базовые ориентиры. Предыдущее лечение, анализы и другие обязательные условия указаны ниже в критериях участия.
Где проводится
Список центров уточняется — проверьте первичный протокол.
Следующий шаг
Сохраните исследование, покажите его лечащему врачу и уточните актуальный статус у исследовательского центра. Расходы, документы и поездка →

Обзор

Rheumatoid arthritis (RA) is characterized as a systemic auto immune disorder linked to a persistent inflammatory process that can harm both joints and extra articular organs. The upregulation of the CCR6/CCL20 axis in the synovial tissues and salivary glands (in cases of secondary Sjögren's syndrome) is considered to contribute to the recruitment of Th17 cells, which in turn enhances IL 17A production and promotes the inflammatory cycle.

Подробное описание

Although the aetiology and progression of RA remain incompletely elucidated, various therapeutic modalities are accessible, significantly altering the prognosis of patients with the disease.

Various cell types are implicated in the pathophysiology of RA, including synovial fibroblasts, osteoclasts, immune associated T and B lymphocytes, and macrophages. The orchestration of these cells induces the release of diverse inflammatory mediators (cytokines and chemokines) that perpetuate the chronic inflammatory response of the disease. Chemokines and their receptors regulate lymphocyte recruitment to inflamed joints in RA. Cytokines, encompassing both pro inflammatory and anti-inflammatory types, are recognized for their essential involvement in the evolution of RA via inflammation and the degradation of articular cartilage.

The chemokine receptor (CCR)6 is a class A GPCR within the chemokine family, noted for its notable therapeutic promise in immunological research.

The sole chemokine ligand for CCR6 is chemokine ligand 20 (CCL20), which is also referred to as macrophage inflammatory protein (MIP) 3α, Exodus 1 and liver and activation regulated chemokine. In humans, it is expressed by neutrophils, Th17 cells and peripheral blood mononuclear cells. This axis has distinct functions in immunological homeostasis and activation.

CCL20 is one of the chemokines mainly produced by inflamed synovial cells in response to cytokines, including TNF-α (tumour necrosis factor-α), IL-1, IL-17, and IL-18.

Synovial T lymphocytes generate cytokines, such as TNFα, IFNγ and IL 17A. The production of pro inflammatory cytokines was originally ascribed to Th1 cells Subsequently, it was elucidated that IL 17A production among Th cells was confined to a distinct Th cell subpopulation, subsequently designated as Th17.

The interaction between CCR6 and CCL20 is critical, not only for the migration of Th17 cells, but also for their activation and differentiation. CCL20 has been shown to be involved in the differentiation of naive T cells into Th17 cells, thereby directly influencing IL 17A production in patients with RA.

Вмешательства

  • Генная терапия Gene expression by quantitative Real Time PCR
    Sample collection: * 5 ml peripheral blood will be collected under sterile conditions. 1-Gene Expression Assay * Total RNA Extraction * cDNA Synthesis * Gene Expression Analysis: o Quantitative Real-Time PCR (qRT-PCR) for CCR6 gene expression using primer as follows: Forward primer (5'-3'): CCACAATGAGCGGGGAATCAATGAA Reverse primer (5'-3'): CAAATAGCCTGGAGAACTGCCTGAC * Normalization using housekeeping gene (GAPDH) Forward primer (5'-3'): GAAACCTGCCAAGTATGATG Reverse primer (5'-3'): AGGAAATG

Первичные конечные точки

  • assess expression of CCR6 gene in peripheral blood leukocytes of RA patients compared to healthy individuals [Срок оценки: within 3 days of samples collection]
Вторичные конечные точки (1)
  • Measure the plasma levels of CCL20 [Срок оценки: within 3 days after samples collection]

Критерии участия

Критерии включения

  • Adults (18-60 years) diagnosed with RA according to the American College of Rheumatology/European League Against Rheumatism (ACR/EULAR) 2010 classification criteria for RA by an expert rheumatologist.

Критерии исключения

  • • Patients with co-existing infections or other autoimmune diseases.

Критерии приведены из реестра в оригинале (на английском). Окончательную оценку соответствия проводит исследовательский центр.

Здоровые добровольцы: Да

Дизайн исследования

Модель наблюдения
Случай-контроль

Центры проведения

Список центров уточняется — проверьте первичный протокол.

Публикации

  • Conforti A, Di Cola I, Pavlych V, Ruscitti P, Berardicurti O, Ursini F, Giacomelli R, Cipriani P. Beyond the joints, the extra-articular manifestations in rheumatoid arthritis. Autoimmun Rev. 2021 Feb;20(2):102735. doi: 10.1016/j.autrev.2020.102735. Epub 2020 Dec 17. PMID 33346115
  • Ciofani M, Madar A, Galan C, Sellars M, Mace K, Pauli F, Agarwal A, Huang W, Parkhurst CN, Muratet M, Newberry KM, Meadows S, Greenfield A, Yang Y, Jain P, Kirigin FK, Birchmeier C, Wagner EF, Murphy KM, Myers RM, Bonneau R, Littman DR. A validated regulatory network for Th17 cell specification. Cell. 2012 Oct 12;151(2):289-303. doi: 10.1016/j.cell.2012.09.016. Epub 2012 Sep 25. PMID 23021777
  • 1- Al Obaidi MJ and Al Ghurabi BH: Potential role of NLRP3 inflammasome activation in the pathogenesis of periodontitis patients with type 2 diabetes mellitus. J Med Chem Sci 6: 522-531, 2023.

Идентификаторы

NCT: NCT07397741 · Soh-Med-26-1-3MD

Первоисточники (государственные реестры)

Открыть это исследование на ClinicalTrials.gov ↗