Gut Microbiota Dysbiosis in Lupus Nephritis
Ориентир для пациента и семьи
Простыми словами
Автоматическая сводка по структурированным данным реестра. Она помогает сориентироваться, но не заменяет официальный протокол или оценку врача.
- Что изучают
- В протоколе указаны: DNA extraction and PCR amplification.
- Кому может быть актуально
- Состояния в реестре: Gut Microbiota Dysbiosis in Lupus Nepheritis. Базовые параметры: 18 лет — 50 лет · Женщины.
- Что важно проверить
- Возраст, диагноз и пол — только базовые ориентиры. Предыдущее лечение, анализы и другие обязательные условия указаны ниже в критериях участия.
- Где проводится
- Список центров уточняется — проверьте первичный протокол.
- Следующий шаг
- Сохраните исследование, покажите его лечащему врачу и уточните актуальный статус у исследовательского центра. Расходы, документы и поездка →
Не всё понятно в терминах? Прочитайте наш гид для пациентов →
Обзор
Evaluate dysbiosis of some intestinal microbiota in adult patients with lupus nephritis compared to healthy controls.
Подробное описание
Systemic Lupus Erythematosus (SLE) is an autoimmune disease resulting in multi-organ inflammation with complex clinical manifestation including neuropsychiatric, lupus nephritis..etc. However, the actual cause of SLE is still unknown \[1\].
Various etiologies have been postulated which can be categorized into genetic and environmental such as age, gender, ultra-violet exposure, dietary intake, alcohol, and lifestyle behavior \[2\].
Lupus nephritis is one of the most severe manifestations of SLE with high mortality rate and 10% of them eventually develop end-stage renal disease within 5 years after diagnosis \[3,4\].
There are trillion of microbes inhabited human gut which dominated by 4 phyla; Firmicutes, Bacteroidetes, Proteobacteria and Actinobacteria. In healthy human gut, 98% of gut microbiota is dominated by Bacteroidetes and Firmicutes. Every species of gut microbiota play their own role in modulating immune system. Many factors could alter gut communities such as infant transition, dietary habit, age, gender and antibiotic consumption \[5, 6\].
Firmicutes responsive in fatty acids and carbohydrates absorption whereas Bacteroidetes correspond to polysaccharides absorption \[7\].
Recently, enormous reports highlighted on the association of autoimmune diseases with dysbiosis of gut microbiota \[8-11\], During the autoimmune disease condition, the symbiotic relationship is broken due to various factor such as dietary habit that change microbiota diversity. The decrease of microbial diversity was found in autoimmune diseases such as SLE and inflammatory bowel disease (IBD), presented by reduce commensal bacteria (Firmicutes and Bacteroidetes) and increase of detrimental bacteria (Proteobacteria and Actinobacteria) \[12\].
Alteration of gut microbiota expresses as Firmicutes/Bacteroidetes ratio (F/B) potentially act as the measurement for pathological condition in SLE patients which cause systemic inflammation. The decreased ratio of F/B microbiome in SLE patients occur either by the reduction in Firmicutes or increase abundance of Bacteroidetes \[13\]. In human study, altered short chain fatty acids (SCFA) fecal level in lupus patient with low F/B ratio suggest the potential link of gut absorption function with microbes \[14\].
Hence, it is necessary to identify the exact mechanism on how the gut microbiota promote SLE and LN pathogenesis in human studies.
Вмешательства
- Генная терапия DNA extraction and PCR amplification
Microbial community genomic DNA extraction from fecal samples will be done using extraction kit in accordance with the manufacturer's instructions. The DNA extract will be checked on a 1% agarose gel, and the DNA concentration and purity will be determined using the NanoDrop 2000 UV-vis spectrophotometer. The hyper-variable region V3-V4 of the bacterial 16S rRNA gene will be amplified with the primer pair 338F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTACHVGGGTATCTAAT) on a PCR thermocycler. PCR amp
Первичные конечные точки
- Evaluate dysbiosis of some intestinal microbiota in adult patients with lupus nephritis compared to healthy controls. [Срок оценки: 2 years]
Критерии участия
Критерии включения
- Adult male and female patients diagnosed with lupus nephritis. Adult age and sex matched healthy individuals will be included as a control group.
Informed consent will be obtained from each study participant.
Критерии исключения
- Subjects at age<18 years. Diseases affecting the gut microbiota (e.g. chronic diarrhea, Crohn's disease, or ulcerative colitis).
Patients on maintenance dialysis, with diabetes or pregnancy, using antibiotics, probiotics, prebiotics, or synbiotics in the previous 4 weeks.
Patients with critical condition (hypertension emergency,urgency, acute myocardial infarction or stroke within the last 6 months) and suspected/confirmed renal vascular disease.
Критерии приведены из реестра в оригинале (на английском). Окончательную оценку соответствия проводит исследовательский центр.
Дизайн исследования
- Модель наблюдения
- Когортное
Центры проведения
Список центров уточняется — проверьте первичный протокол.
Публикации
- Wang A, Zhao J, Qin Y, Zhang Y, Xing Y, Wang Y, Yu Z, Yan J, Han M, Yuan J, Hui Y, Guo S, Ning X, Sun S. Alterations of the gut microbiota in the lupus nephritis: a systematic review. Ren Fail. 2023;45(2):2285877. doi: 10.1080/0886022X.2023.2285877. Epub 2023 Nov 23. PMID 37994423
Идентификаторы
NCT: NCT06231303 · Gut microbiota in LN